Published in Scientific Papers. Series B, Horticulture, Vol. LXIII, Issue 1
Written by Ligia ION, Adrian Constantin ASĂNICĂ
The plum pox virus produces an extremely damaging disease in fruit stone species with major implications in fruit production but also in phytosanitary status of fruit plantation. The genome of the virus encodes a single large polyprotein, a precursor that determines the serological properties of PPV, namely CP (Coat protein). This poly protein is proteolytically catalyzed by 3 viral encoding proteases that can synthesize up to 10 functional proteins. The capsid protein binds to the carboxyl end of the polyprotein. The in vitro properties of the viral extract vary with the strain and the plants used for propagation. Establishing the best primers for the molecular detection of the Plum pox virus is an extremely important stage, so a bioinformatics analysis it’s necessary to identify potential sources of results misconduct (sources of contamination that can produce false positive results) is taken into account. The detection primers P1 5’ ACCGAGACCATCACCCTCCC 3’ and P2 – 5’ CAGACTACACCGTCGCCAGA 3’, were tested for the ability to form the hairpin secondary structure, self-dimerization capability, heterodimerization capability, Tm mismatch through the OligoAnalyzer program from IDT Company. The results have shown that the proposed primers can be used in PCR reactions and the results are not influenced by the artefacts.
[Read full article] {simplepopup link="Citation25"}[Citation]
{/simplepopup}
{simplepopup popup="false" name="Citation25"}ION L., ASANICA A.C. 2019, STUDIES ON THE BIOINFORMATICS ANALYSIS FOR THE PPV (PLUM POX VIRUS) MOLECULAR MARKERS. Scientific Papers. Series B, Horticulture, Vol. LXIII, Issue 1, Print ISSN 2285-5653, 167-170. {/simplepopup}
